Skip to main content
Download PDF

CIRBP mRNA level in breast cancer is associated with HIF1α gene expression and microvascular density

BMC Research Notes volume 18, Article number: 202 (2025) Cite this article

Abstract

Objective

Based on the available evidence, the cold-inducible RNA-binding protein (CIRBP) appears to play a role in increasing the stability of hypoxia-inducible factor 1-alpha (HIF1α) mRNA. This research aimed to examine the levels of CIRBP and HIF1α mRNA within breast tumor tissues and explore the relationship between their gene expression and tumor Microvascular density (MVD).

Results

The results revealed a significant upregulation of CIRBP (5.07-fold) and HIF1α (4.5-fold) gene expression in BC samples compared to the surrounding normal tissues (p < 0.001). This upregulation was also associated with various clinicopathologic features. Furthermore, there was a correlation between CIRBP mRNA expression, HIF1α mRNA expression, and MVD. Consequently, this study suggests that CIRBP may have a role in promoting angiogenesis in BC.

Peer Review reports

Introduction

Breast cancer (BC) is currently considered the most common cancer in women, with 23.6 new cases per 100,000 [1]. In recent times, a multitude of research endeavors have been undertaken to pinpoint novel biomarkers facilitating early detection and treatment monitoring in BC [2,3,4]. Therefore, a deeper understanding of the fundamental mechanisms at play in BC can significantly contribute to the discovery of these new biomarkers. Angiogenesis, the formation of new blood vessels, is crucial for tumor growth and metastasis. Normally, it is regulated by a balance of pro-angiogenic and anti-angiogenic factors. In cancer, this balance is disrupted, leading to new blood vessel formation [5, 6]. Studies has shown that hypoxia-inducible factor 1α (HIF-1α) can directly stimulate the expression of specific angiogenic factors, such as vascular endothelial growth factor (VEGF), thus facilitating the formation of new blood vessels [7]. Notably, local hypoxia is known to occur during the early stages of BC development. In hypoxic conditions, there is a potential elevation in HIF-1α expression within tumor cells, subsequently promoting VEGF-induced angiogenesis [5]. It is important to emphasize the role of local hypoxia during the initial phases of breast cancer development, as it fosters a microenvironment that supports the upregulation of HIF1α and the subsequent induction of VEGF-mediated angiogenesis, which, in turn, drives tumor advancement, invasion, and metastasis [8].

Furthermore, numerous studies have indicated that RNA-binding proteins, known for their role in governing RNA dynamics, have the capacity to influence angiogenesis [9]. Among these, Cold-inducible RNA-binding protein (CIRBP) belongs to the mammalian cold shock protein family and was initially identified in the testes. CIRBP is continuously expressed across various cell types and typically resides in the nucleus, though it can translocate to the cytoplasm under various cellular stressors like hypoxia, UV irradiation, and exposure to cold conditions [9,10,11,12]. Under such stressful circumstances, CIRBP can elevate its own expression through the activation of alternative promoters, a process known as self-transcription. Moreover, Specificity Protein 1 (SP1), acting as a transcriptional regulator, can bind to the 5’ flanking region of the CIRBP gene and enhance CIRBP overexpression [10, 13]. In general, CIRBP binds to the 3’-untranslated region (UTR) of specific target genes, thereby regulating a wide spectrum of physiological and pathological events, including but not limited to cell survival, proliferation, differentiation, senescence, angiogenesis, apoptosis, and inflammatory responses [11, 12]. This multifaceted RNA-binding protein plays a pivotal role in response to stressors by orchestrating its own upregulation through alternative promoters, while the involvement of SP1 further amplifies its expression. Notably, evidence points to CIRBP having distinct roles in various human malignancies [14]. CIRBP has been found to be overexpressed in conditions like melanoma, prostate cancer, colorectal cancer, breast cancer, bladder cancer, and skin squamous cell carcinoma. However, in contrast, in cases of endometrial and ovarian cancer, CIRBP appears to act as a tumor suppressor [9, 15, 16].

Accumulating evidence indicates that CIRBP exhibits a selective affinity for the 3’-UTR sequence of HIF1α mRNA, leading to increased stability and enhanced translation of HIF1α mRNA. Prior research has proposed that CIRBP has the potential to induce the overexpression of HIF-1α in a variety of cancers, including bladder cancer [15]. However, the precise relationship between CIRBP and the angiogenesis process in BC is still unknown. Therefore, the primary objective of this study was to shed light on the role of angiogenesis in the proliferation and metastasis of breast tumor cells. To do this, we examined the mRNA expression levels of CIRBP and HIF1α, as well as MVD, in breast cancer tissues compared to the surrounding non-cancerous tissues.

Methods

Patient and tissue sample collection

We obtained 42 fresh-frozen tissue specimens from the Cancer Institute of Imam Khomeini Hospital in Tehran, following strict ethical guidelines. Non-tumor tissues adjacent to tumors were used as control samples. The sample size was determined using MedCalc statistical software, considering a statistical power of 90% (β = 0.10) and a significance level of 5% (α = 0.05), which corresponds to the probability of committing a Type I error as described by Wang et al.“To control for Type I error, we set the significance level at 5% (α = 0.05), which is a commonly used threshold in biomedical research [17]. Demographic and tumor-specific data were collected. Patients had not undergone prior treatment and those with other cancer histories were excluded. All patients provided informed consent. Tumor size, grade, and stage were classified based on standard clinical and pathological guidelines. Tumor staging followed the TNM classification system established by the American Joint Committee on Cancer (AJCC), while tumor grading was assessed using histological criteria including nuclear pleomorphism, mitotic count, and glandular differentiation. All classifications were confirmed by experienced pathologists. The research followed the Helsinki Declaration and was approved by the Ethics Committee at Ahvaz Jundishapur University. Specimens were fresh-frozen and in liquid nitrogen and securely stored at -75°C for molecular experiments, adhering to STROBE guidelines [18].

RNA isolation and quantitative real-time PCR (qRT-PCR) analysis

To assess gene expression, total RNA was extracted from 42 BC tissues and their adjacent non-cancerous counterparts using RiboEx™ Reagent (Cat. No. 301-001, GeneAll Biotechnology, Seoul, Korea) as per the producer’s guidelines. The quantity and integrity of the isolated RNA were validated employing a Nano Drop 2000 spectrophotometer (Thermo Scientific, USA) and 1.5% agarose gel electrophoresis. The next step complementary DNA (cDNA) was reverse transcripted by Yekta Tajhiz Azma Kit (Cat. No. YT4500, Tehran, Iran), following the kit’s recommended protocol. To measure the expression levels of the CIRBP and HIF1 genes, quantitative real-time PCR (qRT-PCR) procedures were executed using an Applied BiosystemsTM 7500 Real-Time PCR System. Each PCR reaction (12.5 µl) was composed of 6.25 µL of RealQ Plus 2x Master Mix Green (Cat. No. A324402, Amplicon, Denmark), 0.5 µL each of forward and reverse primers (0.2 µM), 2 µL of template DNA, and 3.75 µL of RNase-free water. For data normalization, hypoxanthine phosphoribosyltransferase 1 (HPRT1) was utilized as a housekeeping gene. Specific forward and reverse primer sequences for CIRBP, HIF1α, and HPRT1 genes were obtained as follows: CIRBP Forward primer: AGGGCTGAGTTTTGACACCA, reverse primer: GCCGTCCATCTACAGACTTCC; HIF1α Forward primer: GCAGCAACGACACAGAAACT, reverse primer: TGCAGGGTCAGCACTACTT; HPRT1 Forward primer: CCTGGCGTCGTGATTAGTG, Reverse primer: TCAGTCCTGTCCATAATTAGTCC. In terms of the PCR cycle conditions, a total of 40 cycles were carried out, with each cycle involving a 15-second denaturation step at 95 °C followed by a 1-minute annealing step at 60 °C. This was preceded by an initial pre-incubation stage at 95 °C for 15 min. Furthermore, we assessed the melting curve by gradually increasing the temperature from 60 to 95 °C. The relative quantitative values (Fold Change) for each sample were calculated employing the 2−ΔΔCt formula, with normalization to its respective housekeeping gene [19].

Immunohistochemical analysis

Immunohistochemistry analysis was carried out on thirty-nine paraffin-embedded tissue blocks originating from a pool of forty-two patients. In the case of BC tissues, they underwent fixation in 10% phosphate-buffered formalin before being embedded in paraffin. The 2.5 μm tissue sections underwent deparaffinization overnight in xylene and subsequent rehydration through a series of graded alcohol solutions. To suppress endogenous peroxidase activity, a solution of 3% H2O2-methanol was applied. To minimize non-specific staining, the sections were pre-treated with a 5% normal goat serum for a duration of 30 min. Following this, the sections were incubated overnight at 4 °C with primary antibodies (CD31, diluted to 1:25) (Cat. No. MAD-002048Q, Master Diagnostic, Spain). A subsequent 60-minute incubation with secondary antibodies (MAD-000237QK) followed. The resulting immunoreaction product was visualized through diaminobenzidine staining, and the slides were counterstained with hematoxylin. The examination of tissue sections was conducted using a light microscope. In our study, about ten fields were randomly chosen and examined at 40X magnification, with the resulting mean vessel count calculated across these ten fields [20, 21].

Statistical analysis

Statistical analyses were conducted using GraphPad Prism and SPSS software. Data were presented as Mean ± standard deviation (SD) from at least three independent experiments. Normality was assessed with the Kolmogorov–Smirnov test, and significance was set at p < 0.05. Gene expression between two groups of tumor tissues and control was compared using paired sample t-test. ROC analysis evaluated gene sensitivity and specificity as biomarkers. Pearson correlation coefficient test assessed correlations between CIRBP and HIF1α transcription and their expression with MVD. Comparisons involving clinicopathological factors were made as follows: Independent sample t-test was used for tumor size (< 5 cm vs. ≥ 5 cm), ER status (positive vs. negative), PR status (positive vs. negative), P53 status (positive vs. negative), necrosis (yes vs. no), lymphatic invasion (yes vs. no), vascular invasion (yes vs. no), and stage (II, III). One-way ANOVA was used for tumor grade (I, II, III), Bonferroni correction was applied to adjust the significance level (α) for multiple comparisons. The adjusted significance level was calculated as α, where ensuring a more stringent control of Type I error [20, 22].

Results

Clinicopathological characteristics of patients

Demographic characteristics and clinical pathology of the 42 BC patients revealed that 58% were under 50 years old, while 42% were 50 or older. Additionally, 30.5% of patients were of Azeri ethnicity. The data showed that approximately 71.4% of patients were at stage II, and 47.6% were classified as grade II.Necrosis was present in 64.3% of cases, and vascular/lymphatic invasion was observed in 61.9% of patients. Tumor size analysis indicated that 54.8% of patients had tumors smaller than 5 cm, while 45.2% had tumors 5 cm or larger.

CIRBP and HIF1α expression levels in breast cancer specimens

The QRT-PCR method was employed to assess the mRNA expression of CIRBP and HIF1α genes in 42 BC tissues as well as their corresponding normal adjacent breast tissues. It was evident that the transcript levels of both CIRBP and HIF1α genes exhibited a noteworthy increase in BC tissues when compared to the adjacent normal tissues (P < 0. 001). Specifically, CIRBP and HIF1α transcripts experienced a substantial upsurge of approximately 5.07-fold and 4.5-fold, respectively, in BC samples as opposed to normal samples (P < 0.001), as visually depicted in Fig. 1.

Fig. 1
figure 1

Expression of CIRBP and HIF1 α gene in breast tumor tissues and no-tumor tissues. (A) Graph is showing the mRNA level of CIRBP in breast tumor tissues in compression with non-tumor tissues. (B) Graph is showing the mRNA level of HIF1α in breast tumor tissues in compression with non-tumor tissues. Data were expressed as mean ± standard deviation (SD). HPRT1 was used as a housekeeping gene. ****P < 0.0001 was compared to the normal group—BC = Breast cancer, CIRBP = Cold-inducible RNA-binding protein, HIF1α = Hypoxia-inducible factor 1α, HPRT1 = Hypoxanthine phosphoribosyltransferase1

Full size image

Association between CIRBP and HIF1α mRNA levels and clinicopathological features of patients

Table 1 outlines the findings regarding the correlation between CIRBP mRNA levels and various clinicopathological parameters in BC patients. Our data analysis by independent sample t-test or one way ANOVA unveiled significant associations between elevated CIRBP transcript levels and several clinical parameters, including tumor size (P = 0.016), grade (P<0.001), stage (P = 0.018), necrosis (P = 0.045), lymphatic invasion (P = 0.008), and vascular invasion (P = 0.008). Notably, CIRBP mRNA levels did not demonstrate a significant correlation with other histopathological markers, such as p53, estrogen receptor (ER), and progesterone receptor (PR) (P˃0.05, as indicated in Table 1.

Table 1 Association of CIRBP and HIF1α expression with clinicopathological features
Full size table

As for relationship of HIF1α mRNA expression and the clinicopathological characteristics of BC tissues, the analysis of data by independent sample t-test or one way ANOVA revealed significant disparities in HIF1α gene transcript levels concerning tumor size (P = 0.015), grade (P = 0.027), stage (P = 0.002), lymphatic invasion (P = 0.012), and vascular invasion (P = 0.012). However, it’s worth noting that the HIF1α mRNA levels did not exhibit a significant correlation with other clinicopathological features.

Correlation between the transcriptional levels of CIRBP and HIF1α genes

Within BC tissues and their adjacent normal counterparts, a statistically moderate positive correlation was observed (correlation coefficient (r) = 0.362, P = 0.018) between the normalized expression levels of the CIRBP and HIF1α genes. These results suggest that an escalation in CIRBP expression may indeed play a role in bolstering the stability and subsequent overexpression of the HIF1α gene [23, 24].

MVD evaluation

In Fig. 2, the depiction showcases the density of blood vessels, visually represented by distinct brown dots. The samples have been stratified into categories, distinguishing them as exhibiting low, moderate, or high levels of MVD. Interestingly, we observed that lower CD31 expression levels were evident in the context of grades I and II within BC tissues. In contrast, a pronounced abundance of vessel lumens, as indicated by CD31, was detected in grade III specimens.

Fig. 2
figure 2

Microvessel density in breast tumor tissue. (A) A pathological image of breast cancer (B) A normal image of breast cancer (C) Lack of expression of CD31 in (BC) samples (100X) and (D) (400X). (E) Low level of CD31 expression in grade I of (BC) samples (100X) and (F) (400X). (G) High level of CD31 expression in grade III of (BC)samples (100X) and (H) (400X)

Full size image

Correlation between MVD and clinicopathological features of patients

Table 2 highlights a substantial association between MVD and the clinicopathological characteristics of patients, specifically tumor size, grade, and stage. With an increase in the size (P = 0.005), grade (P = 0.033), and stage (P = 0.002) of the tumor cells, there was a corresponding escalation in MVD induced by these tumor cells. Nonetheless, it’s noteworthy that the MVD did not exhibit a significant correlation with other clinicopathological patient features, including the status of ER, PR, HER2 receptor, p53, necrosis, and vascular-lymphatic invasion.

Table 2 Evaluation of MVD rate with clinicopathological features of breast cancer patients
Full size table

Correlation between MVD with CIRBP and HIF1α transcriptional levels

Within BC tissues and their corresponding normal tissue counterparts, an intriguing observation emerged. A weak negative correlation was unveiled (R=-0.326, P = 0.035) between the ΔCT value of the CIRBP gene and MVD. This finding suggests that a decrease in the ΔCT value of the CIRBP gene may be associated with an increase in MVD rates. However, it’s important to note that the statistical analysis failed to reveal a significant relationship between HIF1α gene expression and the MVD rate (R = 0.052, P = 0.745).

Sensitivity and specificity of CIRBP and HIF1α as biomarkers

The ROC curve was used to evaluate the specificity and sensitivity of the CIRBP and HIF1α genes. The area under the curve (AUC) for CIRBP was 89% (P < 0.001), while for HIF1α it was 91.7% (P < 0.001). With a cut-off of 1.40, CIRBP demonstrated a sensitivity of 93% and a specificity of 75%. In contrast, HIF1α, with a cut-off of 2.60, showed a sensitivity of 86% and a specificity of 91.7%, as illustrated in Fig. 3.

Fig. 3
figure 3

ROC curve analysis of CIRBP and HIF1α genes. (A) ROC curve of CIRBP gene (B) ROC curve of HIF1α gene. (C) ROC curve analysis CIRBP and HIF1α

CIRBP = Cold-inducible RNA-binding protein, HIF1α = Hypoxia-inducible factor 1α

Full size image

Discussion

Given the critical role of CIRBP in cancer biology, our study focused on its expression in breast cancer, along with HIF1α and MVD levels, using RT-qPCR and immunohistochemistry (IHC) analyses. Our results unequivocally showed that CIRBP mRNA expression exhibited a marked elevation in BC tissues when compared to their corresponding noncancerous counterparts. Additionally, our findings shed light on the fact that heightened CIRBP expression was significantly linked to larger tumor size, higher grade, advanced stage, and the presence of lymphatic/vascular invasion. These observations align with the findings of certain prior studies, which have reported instances of CIRBP overexpression particularly in hypoxic conditions [25]. Hence, the hypoxic environment commonly found in solid tumors may plausibly contribute to the heightened expression of CIRBP in breast tumor tissues. This observation is supported by Zhou et al., who reported CIRBP upregulation in renal cell carcinoma tissues compared to non-cancerous tissues. They found a notably positive CIRBP expression in 76.5% of tumor samples, as opposed to adjacent non-tumor tissues, using IHC [26]. Furthermore, our research outcomes displayed disparities when compared to the dynamics of CIRBP in certain other cancer types. For instance, in the case of ovarian cancer, the work of Zou et al. presented a contrasting scenario wherein both mRNA and protein levels of CIRBP exhibited significant reduction in ovarian cancer tissues in contrast to normal tissues. Their mechanistic analysis unveiled that the knockdown of CIRBP led to the suppression of apoptosis, while simultaneously inducing cell proliferation and metastasis in ovarian cancer cells. Additionally, they reported that CIRBP had the capability to bind to the Mitogen-Activated Protein Kinase (MAP2K) gene, thereby bolstering its stability. As per the insights from Zou’s study, it appears that one of the roles assumed by CIRBP as a tumor suppressor in ovarian cancer stems from its influence on MAP2K stability [16]. Roilo et al. provided compelling evidence for the tumor suppressor role of CIRBP, highlighting its capability to interact with the 5’-UTR of p27kip1 mRNA, consequently enhancing its stability [24]. Roilo’s findings diverge from our own, potentially attributed to the examination of CIRBP under distinct conditions. It’s vital to recognize that in vitro data may not precisely mirror in vivo conditions. Considering these observations, CIRBP and HIF1α may serve as promising predictive biomarkers, and their roles in tumor progression suggest they could be explored as potential therapeutic targets, particularly in the context of small molecule inhibitors [27].

Given the established role of CIRBP in cellular stress responses, some studies have reported a connection between CIRBP and HIF1α, highlighting their potential interaction in hypoxia. The study of Lu et al., revealed that CIRBP upregulation possessed the capacity to enhance HIF1α expression in bladder cancer cells. Conversely, the transfection of cells with siRNA targeting CIRBP led to a reduction in HIF1α expression. These observations were underpinned by CIRBP’s ability to bind to the 3’-UTR of HIF-1α mRNA, consequently bolstering the stability of the transcript and facilitating its translation in the context of bladder cancer [15]. In line with the study by Lu et al., our research further corroborated the relationship between CIRBP and HIF1α. We demonstrated that increased CIRBP expression correlated with enhanced HIF1α expression in tumor tissues. These findings reinforce the notion that CIRBP plays a pivotal role in regulating HIF1α expression levels, potentially through mechanisms such as direct binding to the 3’-UTR of HIF1α mRNA, as observed in bladder cancer cells. The study by Zhang et al. supports these findings by suggesting a mechanism in which CIRP (cold-inducible RNA-binding protein) knockout diminishes HIF1α expression in a rat model of renal ischemia-reperfusion injury. They proposed that CIRP knockout upregulates rat Phd3 expression, a critical regulator of HIF-1α. In parallel, experiments in HK-2 cells revealed that this upregulation inhibits HIF-1α following deep hypothermic circulatory arrest (DHCA), potentially initiating ROS-TGF-β1/p38 MAPK activation and mitochondrial apoptotic pathways [28]. Several studies have documented the overexpression of the HIF1α gene in various cancer types. Kaya et al., for instance, noted that heightened levels of HIF1α expression were correlated with the presence of HER-2 expression in HER2-positive patients, as well as in patients lacking ER and PR expression [29]. Our research findings revealed that elevated HIF1α expression was significantly associated with larger tumor size, the presence of necrosis, and a lower incidence of lymphatic and vascular invasion. These findings exhibited a striking parallel with outcomes in endometrial cancer. In a study by Fuzi et al., the mRNA expression levels of HIF1α in endometrial cancer tissues were compared to normal endometrium samples, revealing that heightened HIF1α expression played a promotive role in tumorigenesis. Furthermore, the application of RNA interference (RNAi) for HIF1α knockdown effectively curtailed the proliferation of the endometrial cancer cell line HEC-1 A [30]. Consequently, the heightened presence of HIF1α within cancer cells emerges as a potential driver of malignancy, positioning it as an oncogene.

The primary objective of our study revolved around the assessment of MVD in BC tissues, with a specific focus on its correlation with clinicopathological characteristics and the expression of CIRBP and HIF1α. Our findings compellingly illustrated a substantial association between the MVD rate and critical parameters including tumor size, grade, and stage. This discovery aligns with a study by Krishnapriya et al., who conducted an examination of the MVD rate in advanced BC biopsies from 92 patients, ultimately concluding that MVD was significantly elevated in BC tissues when compared to normal breast tissues. Furthermore, they provided insight into the prognostic potential of MVD by establishing a link between higher MVD and shorter survival periods in BC, thereby advocating for the consideration of MVD as a valuable prognostic marker [31]. In a separate investigation, Agnani et al. identified a notable association between MVD rate and various crucial factors including tumor size, lymph node metastasis, lymphovascular invasion, and tumor grade within the context of invasive ductal carcinoma [32]. Our results further suggest a moderate negative correlation between CIRBP mRNA expression and MVD. Considering that a lower Ct value indicates higher gene expression, it suggests that an increase in gene expression of CIRBP is associated with an increase MVD. Intriguingly, the data unveiled a lack of significant correlation between HIF1α mRNA expression and MVD. This outcome deviates from the conclusions drawn in prior studies [33], possibly influenced in part by the relatively limited number of patients studied and the diminished quality of paraffin blocks housing BC tissues subjected to extended storage periods. In addition, our analysis encompassed an evaluation of the sensitivity and specificity of CIRBP and HIF1α genes, culminating in the identification of high values, specifically 93% and 75% for CIRBP, and 86% and 91.7% for HIF1α, respectively. These remarkable metrics underscore the potential utility of these genes as biomarkers for distinguishing BC tissue from non-cancerous tissue. Nonetheless, it is imperative to acknowledge the inherent limitations within our study. These limitations encompassed the unavailability of patient survival data, which precluded the determination of the role these genes might play in disease prognosis. Additionally, our capacity to measure protein levels of CIRBP and HIF1α was constrained, and the exploration of the interaction between CIRBP and HIF1α remained unexplored within an in vitro system.

Conclusion

This study has revealed that CIRBP and HIF1α gene expression is significantly higher in breast cancer tissues compared to non-cancerous tissues. These findings suggest that these genes may serve as potential biomarkers for distinguishing between cancerous and non-cancerous tissues. However, further studies are needed to establish the prognostic role of CIRBP expression in breast cancer. The increased expression of CIRBP and HIF1α in higher-grade tumors indicates that these genes might also serve as prognostic markers. Additionally, the correlation between CIRBP expression and MVD suggests its potential role in tumor angiogenesis. Understanding these mechanisms could aid in the development of targeted cancer therapies.

Data availability

No datasets were generated or analysed during the current study.

References

  1. Farhood B, Geraily G, Alizadeh A. Incidence and mortality of various cancers in Iran and compare to other countries: a review Article. Iran J Public Health. 2018;47(3):309.

    PubMed  PubMed Central  Google Scholar 

  2. Wu M, Li Q, Wang H. Identification of novel biomarkers associated with the prognosis and potential pathogenesis of breast cancer via integrated bioinformatics analysis. Technol Cancer Res Treat. 2021;20:1533033821992081.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  3. Mishra D, Mishra A, Rai SN, Vamanu E, Singh MP. Identification of prognostic biomarkers for suppressing tumorigenesis and metastasis of hepatocellular carcinoma through transcriptome analysis. Diagnostics 2023.13(5): 965.

  4. Mishra D, Mishra A, Nand Rai S, Vamanu E, P Singh M. Demystifying the role of prognostic biomarkers in breast cancer through integrated transcriptome and pathway enrichment analyses. Diagnostics. 2023;13(6):1142.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  5. de Heer EC, Jalving M, Harris AL. HIFs, angiogenesis, and metabolism: elusive enemies in breast cancer. J Clin Investig. 2020;130(10):5074–87.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  6. Madu CO, Wang S, Madu CO, Lu Y. Angiogenesis in breast cancer progression, diagnosis, and treatment. J Cancer. 2020;11(15):4474.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  7. Tirpe AA, Gulei D, Ciortea SM, Crivii C, Berindan-Neagoe I. Hypoxia: overview on hypoxia-mediated mechanisms with a focus on the role of HIF genes. Int J Mol Sci. 2019;20(24):6140.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  8. Zarychta E, Ruszkowska-Ciastek B. Cooperation between angiogenesis, vasculogenesis, chemotaxis, and coagulation in breast cancer metastases development: pathophysiological point of view. Biomedicines. 2022;10(2):300.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  9. Kim Y-M, Hong S. Controversial roles of cold–inducible RNA–binding protein in human cancer. Int J Oncol. 2021;59(5):1–11.

    Article  Google Scholar 

  10. Liao Y, Tong L, Tang L, Wu S. The role of cold-inducible RNA binding protein in cell stress response. Int J Cancer. 2017;141(11):2164–73.

    Article  CAS  PubMed  Google Scholar 

  11. Qin H, Ni H, Liu Y, Yuan Y, Xi T, Li X, Zheng L. RNA-binding proteins in tumor progression. J Hematol Oncol. 2020;13(1):1–23.

    Article  Google Scholar 

  12. Zhong P, Huang H. Recent progress in the research of cold-inducible RNA-binding protein. Future Sci OA. 2017;3(4):FSO246.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  13. Kim SY, Ban H-J, Lee S. Jin. Regulation of CIRP by genetic factors of SP1 related to cold sensitivity. Front Immunol. 2022;13:994699.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  14. Lujan DA, Ochoa JL, Hartley RS. Cold-inducible RNA binding protein in cancer and inflammation. Wiley Interdisciplinary Reviews: RNA. 2018;9(2):e1462.

    Article  Google Scholar 

  15. Lu M, Ge Q, Wang G, Luo Y, Wang X, Jiang W, Liu X, Wu C-L, Xiao Y, Wang X. CIRBP is a novel oncogene in human bladder cancer inducing expression of HIF-1α. Cell death & disease. 2018.9(10): 1–15.

  16. Zou D, Wang D, Zhou Q, Yu J. Downregulation of RNA binding protein CIRBP (cold-inducible RNA-binding protein) promotes ovarian cancer progression by regulating MAP2K4 mRNA stability and translation. Gynecol Oncol. 2019;154:66.

    Article  Google Scholar 

  17. Wang M, Zhang H, Heng X, Pang Q, Sun A. Expression of cold-inducible RNA-binding protein (CIRP) in pituitary adenoma and its relationships with tumor recurrence. Med Sci Monitor: Int Med J Experimental Clin Res. 2015;21:1256.

    Article  CAS  Google Scholar 

  18. von Elm ME, Altman DG, Egger M, Pocock SJ, Gøtzsche PC, Vandenbroucke JP. The strengthening the reporting of observational studies in epidemiology (STROBE) statement: guidelines for reporting observational studies. Ann Intern Med. 2007;147(8):573.

    Article  Google Scholar 

  19. Moazeni-Roodi A, Allameh A, Harirchi I, Motiee-Langroudi M, Garajei A. Studies on the contribution of Cox-2 expression in the progression of oral squamous cell carcinoma and H-Ras activation. Pathol Oncol Res. 2017;23(2):355–60.

    Article  CAS  PubMed  Google Scholar 

  20. Mohammed RA, Ellis IO, Mahmmod AM, Hawkes EC, Green AR, Rakha EA, Martin SG. Lymphatic and blood vessels in basal and triple-negative breast cancers: characteristics and prognostic significance. Mod Pathol. 2011;24(6):774–85.

    Article  CAS  PubMed  Google Scholar 

  21. Weidner N. Current pathologic methods for measuring intratumoral microvessel density within breast carcinoma and other solid tumors. Breast Cancer Res Treat. 1995;36(2):169–80.

    Article  CAS  PubMed  Google Scholar 

  22. Ahani M, Ghaderian SMH, Azma MM, Kamali K, Gargari BN, Vojdani S. Association of STAT3, PTPRT, TNK2-AS1, LINC-ROR genes expression level with prostate Cancer and benign prostatic hyperplasia. Int J Cancer Manage 2022.15(1).

  23. Juan Y, Haiqiao W, Xie W, Huaping H, Zhong H, Xiangdong Z, Kolosov VP, Perelman JM. Cold-inducible RNA-binding protein mediates airway inflammation and mucus hypersecretion through a post-transcriptional regulatory mechanism under cold stress. Int J Biochem Cell Biol. 2016;78:335–48.

    Article  PubMed  Google Scholar 

  24. Roilo M, Kullmann MK, Hengst L. Cold-inducible RNA-binding protein (CIRP) induces translation of the cell-cycle inhibitor p27Kip1. Nucleic Acids Res. 2018;46(6):3198–210.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  25. Wellmann S, Bührer C, Moderegger E, Zelmer A, Kirschner R, Koehne P, Fujita J, Seeger K. Oxygen-regulated expression of the RNA-binding proteins RBM3 and CIRP by a HIF-1-independent mechanism. J Cell Sci. 2004;117(9):1785–94.

    Article  CAS  PubMed  Google Scholar 

  26. Zhou KW, Jiang K, Zhu W, Weng G. Expression of cold–inducible RNA–binding protein (CIRP) in renal cell carcinoma and the effect of CIRP downregulation cell proliferation and chemosensitivity to gemcitabine. Oncol Lett. 2018;15(5):7611–6.

    PubMed  PubMed Central  Google Scholar 

  27. Thumpati P, Rai SN, Prajapati C, Ramakrishna K, Singh SK. Targeting c-MYC G-Quadruplexes for Cancer treatment with small molecules. Sci Pharm. 2025;93(1):6.

    Article  CAS  Google Scholar 

  28. Zhang P, Bai L, Tong Y, Guo S, Lu W, Yuan Y, Wang W, Jin Y, Gao P, Liu J. CIRP attenuates acute kidney injury after hypothermic cardiovascular surgery by inhibiting PHD3/HIF-1α-mediated ROS-TGF-β1/p38 MAPK activation and mitochondrial apoptotic pathways. Mol Med. 2023;29(1):61.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  29. Kaya A, Gunel N, Benekli M, Akyurek N, Buyukberber S, Tatli H, Coskun U, Yildiz R, Yaman E. Ozturk. Hypoxia inducible factor-1 alpha and carbonic anhydrase IX overexpression are associated with poor survival in breast cancer patients. J Buon. 2012;17(4):663–8.

    CAS  PubMed  Google Scholar 

  30. Fuzi AAM, Omar SZ, Mohamed Z, Adenan NAM, Mokhtar NM. High throughput Silencing identifies novel genes in endometrioid endometrial cancer. Taiwan J Obstet Gynecol. 2018;57(2):217–26.

    Article  Google Scholar 

  31. Krishnapriya S, Malipatil B, Surekha S, Sundersingh S, Sridevi V, Ananthi B, Selvaluxmy G, Ganesan TS. Microvessel density (MVD) in locally advanced breast cancer. Asian Pac J Cancer Prevention: APJCP. 2019;20(5):1537.

    Article  CAS  Google Scholar 

  32. Agnani B, Solanki R, Ansari M, Agnani S. Prognostic significance of microvessel density as assessed by anti CD34 monoclonal antibody in invasive ductal carcinoma of breast. Asian Pac J Cancer Biology. 2020;5(3):75–9.

    Article  CAS  Google Scholar 

  33. Cui W, Xiao Y, Zhang R, Zhao N, Zhang X, Wang F, Liu Y, Zhang X, Hao J. SOHLH2 suppresses angiogenesis by downregulating HIF1α expression in breast Cancer. Mol Cancer Res. 2021;19(9):1498–509.

    Article  CAS  PubMed  Google Scholar 

Download references

Acknowledgements

This article constitutes a part of Sajad Monjezi’s master dissertation at Ahvaz Jundishapur University of Medical Sciences. The authors wish to extend their heartfelt appreciation to the entire team and mentors at Ahvaz Jundishapur University of Medical Sciences for their valuable contributions to this research.

Funding

This study was financially supported Ahvaz Jundishapur University of Medical Sciences (grant number: CMRC-0050).

Author information

Authors and Affiliations

  1. Department of Biochemistry, School of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran

    Sajad Monjezi, Maryam Cheraghzadeh & Maryam Adelipour

  2. Department of Pathology, School of Medicine, Cancer Institute, Tehran University of Medical Science, Tehran, Iran

    Vahid Soleimani

  3. Department of Biostatistics and Epidemiology, School of Health, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran

    Saeed Ghanbari

  4. Cellular and molecular research center, Medical Basic Science Research Institute, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran

    Sajad Monjezi & Maryam Adelipour

Authors
  1. Sajad Monjezi
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Vahid Soleimani
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Maryam Cheraghzadeh
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Saeed Ghanbari
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Maryam Adelipour
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

S.M. and M.A. contributed to design of the research; S.M., M.A., V.S., S.G. and M.C. collected the data; S.M. and M.A. contributed to interpretation of the data; S.M. wrote the main manuscript; M.A. revised the manuscript. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Maryam Adelipour.

Ethics declarations

Ethical approval and consent to participate

This study was performed in accordance with the principles of the Declara-tion of Helsinki. All patients of have declared their informed consent through a written consent letter to be involved in this study. This study is approved by the ethics committee of the cancer institute of Imam Khomeini hospital (Tehran, Iran) and the ethics committee of Ahvaz Jundishapour University of medical sciences (Ahvaz, Iran) (IR.AJUMS.MEDICINE.REC. 1400.052).

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Conflict of interest

The authors declared no conflicts of interest.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Monjezi, S., Soleimani, V., Cheraghzadeh, M. et al. CIRBP mRNA level in breast cancer is associated with HIF1α gene expression and microvascular density. BMC Res Notes 18, 202 (2025). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13104-025-07265-5

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s13104-025-07265-5

Keywords

BMC Research Notes

ISSN: 1756-0500

Contact us