OsHMA3 overexpression works more efficiently in generating low-Cd rice grain than OsNramp5 knockout mutation

Abstract

Objective

Cadmium (Cd) is a highly toxic metal element and a carcinogen to humans. Rice is prone to taking up Cd from paddy fields and accumulating it in grain, which raises health concerns for rice consumers. OsNramp5 is a major transporter for Cd and manganese (Mn) uptake in rice, whereas OsHMA3 is a tonoplast-localized transporter involved in Cd detoxification in vacuoles. In this study, we compared the efficiency of OsNramp5 knockout mutation and OsHMA3 overexpression in reducing Cd content in rice grain.

Results

The grain Cd content of the OsNramp5 knockout mutants was significantly lower than that of the wild-type rice T5105. However, these mutants still had much higher grain Cd content than the previously reported OsNramp5 mutants or the OsHMA3 overexpression lines developed in our previous study. Pyramiding the OsNramp5 mutant allele and the OsHMA3 transgene in a single line did not result in an additional reduction in grain Cd content. The OsNramp5 gene in T5105 has a haplotype II promoter, and its knockout mutation also partially reduced Mn content in rice grain. Our results demonstrate that OsHMA3 overexpression works more efficiently in generating low-Cd rice grain than OsNramp5 knockout mutation without affecting Mn uptake in rice.

Introduction

Cadmium (Cd) and its compounds are highly toxic for most living organisms. Long-term exposure of the human body to Cd may lead to cancer and toxicity in organ systems. Rice is a staple cereal crop for over 40% of the world’s population. Compared to other crops, rice is prone to taking up Cd from paddy fields and accumulating it in grain, which makes rice the major source of dietary Cd exposure. Several genes on Cd uptake, transport, and detoxification in rice have been isolated and characterized in recent years [1,2,3,4,5]. Among these, OsNramp5 is a major transporter for Cd uptake in rice [1,2,3]. The OsNramp5 knockout mutant derived from physical mutagenesis significantly reduces Cd content in the rice grain [1]. The OsNramp5 knockout mutants derived from gene editing were used to generate low-Cd rice [6, 7]. Since OsNramp5 is also a major transporter for manganese (Mn) uptake in rice and Mn is essential for rice growth and development, the OsNramp5 knockout mutation might result in impaired growth, development, reproduction and stress response, especially when grown at low Mn concentrations [3, 8].

OsHMA3 is a tonoplast-localized transporter belonging to the P1B-type Heavy Metal ATPase family [4, 5]. OsHMA3 transports Cd from the cytosol into vacuoles in root cells for Cd detoxification, which effectively restricts Cd loading into the xylem for long-distance transport to shoot and grain. Overexpression of the OsHMA3 gene in rice selectively and significantly reduced Cd accumulation in grain and enhanced Cd tolerance [4, 9, 10]. We recently developed OsHMA3 overexpression lines in the genetic background of rice variety T5105 [11]. The Cd concentration in the grain of the OsHMA3 overexpression lines was significantly reduced, while the concentrations of other nutrient metal elements in the transgenic rice were not affected [11]. In this study, we generated OsNramp5 knockout mutants using CRISPR/Cas9 technology and compared them with the OsHMA3 overexpression lines on their efficiency in reducing Cd content in rice grain. The results would provide helpful information and guidelines on generating low-Cd rice through genetic engineering.

Main text

Materials and methods

Plant materials, growth conditions, and cd treatment

T5105 is an improved aromatic rice line in the KDML105 genetic background [12]. Nipponbare is a japonica cultivar. HMA3-L3 is an OsNramp5 overexpression line carrying the P_Actin1:cHMA3:T_Nos gene in T5105 genetic background [11]. Rice plants were grown in pot soil in a greenhouse at 24–33 °C under natural light with a day length of 12 h. The soil used for rice plantation was a 1:1 mixture (by weight) of garden soil and BVB Peatmoss (Kekkilä-BVB), containing background levels of Cd at 0.436 mg/kg and Mn at 734.774 mg/kg, respectively. For the Cd treatment, the control mixed soil was supplemented with 3 mg/kg of Cd supplied as CdSO₄ [11].

Constructs and rice transformation

Gene editing on OsNramp5 was carried out according to the method described previously [6]. A specific DNA target sequence and its adjacent protospacer adjacent motif (PAM) (AGGTTCTTCCTGTACGAGAGCGGG) were designed for CRISPR/Cas9-mediated gene editing of exon 9 in OsNramp5. The expression cassette, containing the target sequence and the gRNA under the rice snRNA U3 promoter in vector pYLsgRNA-OsU3, was amplified and cloned into the vector pYLCRISPR/Cas9P_Ubi-H to make binary construct pYLCas9-Nramp5. pYLCas9-Nramp5 was introduced into the Agrobacterium tumefaciens strain AGL1 by electroporation. The Agrobacterium-mediated transformation of T5105 was performed according to the procedures described previously [11].

ICP-MS

The contents of Cd and Mn in the de-husked but unpolished brown rice were determined by ICP-MS (7700 S, Agilent Technologies, USA) as described in the previous study [11].

qRT-PCR

Total RNA extraction from rice root tissues, the first-strand cDNA synthesis and qRT-PCR analysis were carried out according to the methods described in our previous report [11]. The qRT-PCR results were normalized against the rice elongation factor gene OsEF-1α (Os03g0178000). The relative expression levels of OsNramp5 were determined using the 2^–ΔΔCt relative quantification method with the expression level in Nipponbare arbitrarily set to 1. The oligo DNA primer pairs are 5’GTCGCCGTCGTCTACCT3’/5’GTACGGCAAGGGCTCGT3’ for the OsNramp5 gene.

and 5’GCACGCTCTTCTTGCTTTC3’/5’AGGGAATCTTGTCAGGGTTG3’ for the OsEF-1α gene.

Results and discussion

We recently developed low-Cd rice lines in the genetic background of rice variety T5105 by overexpressing OsHMA3 under the control of rice OsActin1 promoter [11]. To suppress Cd uptake, we generated three independent knockout mutants of OsNramp5 by using CRISPR-Cas9 technology (Fig. 1A and B). The Cd contents in the grain of these knockout mutants (0.678±0.336 mg/kg to 0.715±0.217 mg/kg) were significantly lower than that of T5105 (1.561±0.398 mg/kg) when grown in Cd-contaminated soil (Fig. 1C). However, the Cd content in the grain of the OsNramp5 knockout mutants was still significantly higher than that in the grain of the OsNramp5 knockout mutants obtained through mutagenesis or gene editing in the previous reports [1, 6]. As for the efficiency in grain Cd reduction, the Cd content in the grain of the OsNramp5 knockout mutants was partially reduced by 54.2–56.6% over that of T5105, which was also significantly lower than that in the previous reports [1, 6]. Similar to the OsNramp5 mutants reported in the previous studies [3], the knockout mutation in this study partially affected Mn uptake and resulted in lower grain Mn content than the wild-type rice when they were grown in either control or Cd-contaminated soil (Fig. 1D). However, no significant change in the phenotype including seed setting rate was observed in the OsNramp5 knockout mutants. Thus, the partial reduction in Mn uptake did not affect plant growth and development, possibly due to the high background level of Mn concentration (734.774 mg/kg) in the soil [3].

Fig. 1

Generation of OsNramp5 knockout mutants. (A) Schematic diagram of OsNramp5 gene structure. UTRs, exons, and introns are indicated by grey blocks, black blocks, and lines, respectively. The nucleotide sequences of the CRISPR/Cas9 target together with PAM (GGG) and the gene edited OsNramp5 mutants are shown at the bottom of the gene structure. Deletions and insertions are indicated by dashes and red letters, respectively. (B) Alignment of amino acid sequences of OsNramp5 and its variants. The amino acid sequences were aligned by Clustral W method under the software MegAlign and viewed by software GeneDoc. The identical residues among all aligned proteins were highlighted in black. (C) Grain Cd content of T5105 and OsNramp5 knockout mutants. (D) Grain Mn content of T5105 and OsNramp5 knockout mutants. Asterisks in (C) and (D) indicate a significant difference between T5105 and OsNramp5 mutants at ** P < 0.01 by Student’s t-test. All data are means ± SD of at least three biological replicates

The representative OsNramp5 mutant line nramp5-L45 was then selected for comparative analysis with HMA3-L3, a representative OsHMA3 overexpression line developed in the previous study [11]. The Cd content in the grain of nramp5-L45 was 1.038±0.079 mg/kg when it was grown in Cd-contaminated soil, which was lower than that of T5105 at 1.720±0.137 mg/kg, but still much higher than the maximum level (ML) of Cd in rice at 0.4 mg/kg set by the Codex Alimentarius Commission (Codex) (Fig. 2A) [13]. Pyramiding the OsNramp5 mutant allele from nramp5-L45 and the P_Actin1:cHMA3:T_Nos gene from HMA3-L3 in a double homozygous line, designated as NH, did not result in any significant Cd reduction in the grain of NH when compared to that of HMA3-L3 (Fig. 2A). The grain Cd contents of HMA3-L3 and NH were 0.027±0.005 mg/kg and 0.020±0.003 mg/kg, respectively (Fig. 2A). Both were significantly lower than the set ML of Cd in rice by Codex. Both nramp5-L45 and NH had lower grain Mn contents than T5105 (Fig. 2B). However, there was no significant difference in Mn content in the grain between HMA3-L3 and T5105, indicating that the OsHMA3 overexpression did not affect Mn uptake in rice (Fig. 2B) [11]. The partial impairment of Cd and Mn accumulation in the grain of the OsNramp5 knockout mutants suggests the existence of other transporters for Cd and Mn uptake. One example could be the iron transporter OsNramp1, a plasma membrane-localized transporter for Mn and Cd [14, 15]. OsNramp1 was found to play a complementary, but not redundant, function to OsNramp5 in the uptake of Mn and Cd based on their differences in gene expression patterns to Cd exposure, subcellular localization of proteins in root cells and relative distribution of Mn and Cd between root and shoot in knockout mutants [14].

Fig. 2

Cd and Mn contents in the grain of rice lines. (A) Cd content in the grain of T5105, nramp5-L45, HMA3-L3 and NH. (B) Mn content in the grain of T5105, nramp5-L45, HMA3-L3 and NH. Different letters in (A) and (B) indicate statistically different at P < 0.05 according to LSD’s test. All data are means ± SD of at least three biological replicates

Based on single nucleotide polymorphisms (SNPs) in the promoters, the OsNramp5 genes in different rice varieties could be classified into three haplotypes: Haplotype I, Haplotype II and Haplotype III [16]. OsNramp5 carrying a Haplotype I promoter has a higher expression level than those carrying a Haplotype II or Haplotype III promoter [16]. Rice varieties carrying OsNramp5 with a Haplotype I promoter also accumulate more Mn in brown rice [16]. Genome sequencing revealed that the OsNramp5 gene in T5105 carries a Haplotype II promoter (Fig. 3A) [11]. Further qRT-PCR analysis confirmed that the OsNramp5 gene in T5105 had a lower expression level in root than the OsNramp5 gene in Nipponbare, a cultivar harbouring an OsNramp5 gene with a Haplotype I promoter (Fig. 3B) [16]. Since OsNramp1 plays a similar and complementary function to OsNramp5 in the uptake of Mn and Cd [14], the relatively low expression level of the OsNramp5 gene in T5105 might weaken its contribution to Cd and Mn uptake. Therefore, the single knockout mutation of OsNramp5 may only partially impair Cd and Mn uptake in rice (Figs. 1C and D and 2A and B). Since Mn is essential for rice, OsNramp5 knockout mutants may affect rice growth, development, yield and tolerance to high temperatures under insufficient Mn supply from soil [3, 8]. Nevertheless, the OsNramp5 knockout mutants and the OsHMA3 overexpression lines developed in the present and previous studies enable farmers to produce low-Cd rice in Cd-contaminated paddy fields, where the soil Cd contents might be around or above 3 mg/kg [1, 6, 11, 17]. Compared to the OsNramp5 knockout mutants, the OsHMA3 overexpression lines performed more efficiently in reducing Cd content in rice grain without affecting Mn uptake in rice.

Fig. 3

Haplotypes of OsNramp5 promoters in rice varieties and their relative expression levels. (A) Haplotypes of OsNramp5 promoters and SNPs. The SNPs in Haplotype I to Haplotype III promoters of OsNramp5 genes published by Liu et al., (2017) were listed as the references above the SNPs in the promoters of the OsNramp5 genes in Nipponbare (NB) and T5105. (B) Relative expression of the OsNramp5 genes in the root of Nipponbare and T5105 detected by qRT-PCR. The expression level of OsNramp5 in the root of Nipponbare was set as 1. Asterisks in (B) indicate a significant difference between Nipponbare and T5105 at ** P < 0.01 by Student’s t-test

Limitations

The contribution of OsNramp5 to Cd and Mn uptake and transport may work in a haplotype- or variety-dependent manner. The conclusion in this report was based on results obtained from the OsNramp5 knockout mutants and the OsHMA3 overexpression lines in T5105 genetic background. It remains to be further investigated whether this also applies to other rice varieties or cultivars.